Hypothetical protein BG908_05820 201bp in pUC vector - 100ug plasmid + 200ul glycerol

(0 przegląd)

1746,40 zł 1746.4 PLN 1746,40 zł VAT Excluded

370,00 € VAT Excluded

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    DNA sequence: 

    RC46GOI: atgagaaattctacttataaacaaaacaaaatttttattttagcctatgttatatttggattgttcatgggtctattttttgacttattgttatcaactcacatatacacattaagtcttttaagtatattttttggcttttttatactaggagtaatctttaagattatcctttcatgccaaaataaaaaacatatttag

    Protein sequence: