pProEX HTA plasmid - 2ug


1491,52 zł 1491.52 PLN 1491,52 zł

316,00 €

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    pProEX HTA Plasmid

    PVT0373-1   2ug

    pProEX HTA Plasmid Infomation

    Plasmid type: expression of Escherichia coli

    Expression level: high

    Cloning methods: polyclonal sites, restrictive endonucleases

    Carrier size: 4751bp

    Sequence primer sequence of 5'sequencing: M13/pUC Reverse: AGCGGATAACAATTTCACACAGG (Invitrogen)

    Sequence primer sequence of 3'sequencing: pTrcHis Reverse: GATTTAATCTGTATCAGG (Invitrogen)

    Carrier label: N-His, N-TEV protease cutting site

    Carrier resistance: ampicin


    Hosts: E.coli. Related vectors: pBR322.

    Product directory number: 50609

    Stability: instantaneous expression of Transient

    Composition / inducible type: inducible type

    Virus / non virus: non virus

    pProEX HTA Plasmid Description
    pProEX HT series prokaryotic expression system is a carrier used to express foreign proteins in Escherichia coli. The target protein expressed by this carrier contains 6 His purify labels. The target gene can be cloned into the polyclonal site of the vector. After the expression of pProEX HTa, B and C. protein is selected, the His purification tag is located at the N end of the target protein. Meanwhile, the use of His purification tag can be used for protein purification. The rTEV protease identification site is also contained on the carrier, and the rTEV protease can be used for enzyme digestion to remove the fused His label.


    pProEX HTA Plasmid Sequence

    LOCUS       pPROEX HTa    4751 bp     DNA    circular     SYN
      ORGANISM  other sequences; artificial sequences; vectors.
    FEATURES             Location/Qualifiers
         source          1..4751
                         /organism="pPROEX HTa"
                         /mol_type="other DNA"
         promoter        193..266
         misc_feature    235..257
         misc_feature    complement(472..489)
         misc_feature    complement(472..489)
         terminator      522..679
         terminator      645..688
         terminator      820..847
         promoter        889..917
         gene            959..1819
         CDS             959..1819
                         /label="ORF frame 2"
         rep_origin      1974..2593
         rep_origin      complement(2931..3237)
         misc_feature    3452..3474
         misc_feature    3621..4712
         CDS             3753..4712
                         /label="ORF frame 3"
     4741 GAATTGATCT G

    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.