pCAGGS - 2 ug

(0 przegląd)

1930,48 zł 1930.48 PLN 1930,48 zł VAT Excluded

409,00 € VAT Excluded

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych


    PVT1020  2ug                                                                                Data sheet 

    pCAGGS Information

    Promoter: CAG promoter

    Replicator: SV40 ori, ori

    Terminator: beta -globin poly (A) signal

    Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid.

    Plasmid size: 4801bp

    Prokaryotic resistance: ampicillin Amp (100 u g/ml)

    Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

    Culture conditions: 37 centigrade, aerobic, LB

    Expression host: mammalian cells such as 293T

    Culture conditions: 37 C, 5%CO2

    Induction mode: no induction, instantaneous expression

    5'sequencing primers: pcaggs-F (GTTCGGCTTCTGGCGTGT)

    3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG)


    pCAGGS Description

    pCAGGS plasmid can be used to express gene efficiently under the control of chicken b- actin, rabbit b- globulin heterozygous promoter (CAG), and human CMV-IE enhancer in various mammalian cells. The CAG promoter sequence is part of the chicken b- actin promoter, the first exon and the first intron (it seems to have strong enhanced subtype activity. " It is linked to the rabbit b- globin fragment, the 3'part of the second intron includes the branching point needed for normal splicing reaction and the 5' portion of the third exon.

    This plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.


    pCAGGS Sequence

    LOCUS       Exported                4801 bp ds-DNA     circular SYN 18-MAY-2017

    DEFINITION  synthetic circular DNA


    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 4801)

      TITLE     Direct Submission

      JOURNAL   Exported Thursday, May 18, 2017

    FEATURES             Location/Qualifiers

         source          1..4801

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         polyA_site      158..213

                         /note="beta-globin poly(A) signal"

                         /note="rabbit beta-globin polyadenylation signal"

         primer_bind     complement(574..590)

                         /note="M13 rev"

                         /note="common sequencing primer, one of multiple similar 


         protein_bind    598..614

                         /bound_moiety="lac repressor encoded by lacI"

                         /note="lac operator"

                         /note="The lac repressor binds to the lac operator to 

                         inhibit transcription in E. coli. This inhibition can be 

                         relieved by adding lactose or 

                         isopropyl-beta-D-thiogalactopyranoside (IPTG)."

         promoter        complement(622..652)

                         /note="lac promoter"

                         /note="promoter for the E. coli lac operon"

         protein_bind    666..687

                         /bound_moiety="E. coli catabolite activator protein"

                         /note="CAP binding site"

                         /note="CAP binding activates transcription in the presence 

                         of cAMP."

         promoter        746..941

                         /note="SV40 promoter"

                         /note="SV40 early promoter"

         rep_origin      792..927

                         /note="SV40 ori"

                         /note="SV40 origin of replication"

         polyA_signal    947..1081

                         /note="SV40 poly(A) signal"

                         /note="SV40 polyadenylation signal"

         rep_origin      complement(1319..1907)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(2078..2938)





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"







         promoter        complement(2939..3043)


                         /note="AmpR promoter"

         enhancer        3074..3453

                         /note="CMV enhancer"

                         /note="human cytomegalovirus immediate early enhancer"

         promoter        3455..3732

                         /note="chicken beta-actin promoter"

         intron          3733..4750

                         /note="chimeric intron"

                         /note="chimera between introns from chicken beta-actin and 

                         rabbit beta-globin"


            1 ttcctcgagg aattcactcc tcaggtgcag gctgcctatc agaaggtggt ggctggtgtg

           61 gccaatgccc tggctcacaa ataccactga gatctttttc cctctgccaa aaattatggg

          121 gacatcatga agccccttga gcatctgact tctggctaat aaaggaaatt tattttcatt

          181 gcaatagtgt gttggaattt tttgtgtctc tcactcggaa ggacatatgg gagggcaaat

          241 catttaaaac atcagaatga gtatttggtt tagagtttgg caacatatgc ccatatgctg

          301 gctgccatga acaaaggttg gctataaaga ggtcatcagt atatgaaaca gccccctgct

          361 gtccattcct tattccatag aaaagccttg acttgaggtt agattttttt tatattttgt

          421 tttgtgttat ttttttcttt aacatcccta aaattttcct tacatgtttt actagccaga

          481 tttttcctcc tctcctgact actcccagtc atagctgtcc ctcttctctt atggagatcc

          541 ctcgacctgc agcccaagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg

          601 ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggt

          661 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg

          721 ggaaacctgt cgtgccagcg gatccgcatc tcaattagtc agcaaccata gtcccgcccc

          781 taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct

          841 gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga

          901 agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctaact tgtttattgc

          961 agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt

         1021 ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctggat

         1081 ccgctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct

         1141 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca

         1201 gctcactcaa aggcggtaat acggttatcc acagaatcag ggataacgca ggaaagaaca

         1261 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt

         1321 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc

         1381 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct

         1441 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg

         1501 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca

         1561 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact

         1621 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta

         1681 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta

         1741 actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct

         1801 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt

         1861 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga

         1921 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca

         1981 tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat

         2041 caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg

         2101 cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt

         2161 agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag

         2221 acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc

         2281 gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag

         2341 ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca

         2401 tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa

         2461 ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga

         2521 tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata

         2581 attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca

         2641 agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg

         2701 ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg

         2761 ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg

         2821 cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag

         2881 gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac

         2941 tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca

         3001 tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag

         3061 tgccacctgg gtcgacattg attattgact agttattaat agtaatcaat tacggggtca

         3121 ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct

         3181 ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta

         3241 acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac

         3301 ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt

         3361 aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag

         3421 tacatctacg tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc

         3481 actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta

         3541 ttttgtgcag cgatgggggc gggggggggg ggggggcccc ccccaggcgg ggcggggcgg

         3601 ggcgaggggc ggggcggggc gaggcggaaa ggtgcggcgg cagccaatca gagcggcgcg

         3661 ctccgaaagt ttccttttat ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc

         3721 gcgcggcggg cgggagtcgt tgcgcgctgc cttccccccg tgccccgctc cgccgccgcc

         3781 tcgcgccgcc cgccccggct ctgactgacc gcgttactcc cacaggtgag cgggcgggac

         3841 ggcccttctc ctccgggctg taattagcgc ttggtttaat gacggcttgt ttcttttctg

         3901 tggctgcgtg aaagccttga ggggctccgg gagggccctt tgtgcggggg gagcggctcg

         3961 gggggtgcgt gcgtgtgtgt gtgcgtgggg agcgccgcgt gcggctccgc gctgcccggc

         4021 ggctgtgagc gctgcgggcg cggcgcgggg ctttgtgcgc tccgcagtgt gcgcgagggg

         4081 agcgcggccg ggggcggtgc cccgcggtgc ggggggggct gcgaggggaa caaaggctgc

         4141 gtgcggggtg tgtgcgtggg ggggtgagca gggggtgtgg gcgcgtcggt cgggctgcaa

         4201 ccccccctgc acccccctcc ccgagttgct gagcacggcc cggcttcggg tgcggggctc

         4261 cgtacggggc gtggcgcggg gctcgccgtg ccgggcgggg ggtggcggca ggtgggggtg

         4321 ccgggcgggg cggggccgcc tcgggccggg gagggctcgg gggaaggggc gcggcggccc

         4381 ccggagcgcc ggcggctgtc gaggcgcggc gagccgcagc cattgccttt tatggtaatc

         4441 gtgcgagagg gcgcagggac ttcctttgtc ccaaatctgt gcggagccga aatctgggag

         4501 gcgccgccgc accccctcta gcgggcgcgg ggcgaagcgg tgcggcgccg gcaggaagga

         4561 aatgggcggg gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc ctctccagcc

         4621 tcggggctgt ccgcgggggg acggctgcct tcggggggga cggggcaggg cggggttcgg

         4681 cttctggcgt gtgaccggcg gctctagagc ctctgctaac catgttcatg ccttcttctt

         4741 tttcctacag ctcctgggca acgtgctggt tattgtgctg tctcatcatt ttggcaaaga

         4801 a


    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.


    Search name

    pCAGGS,Plasmid pCAGGS,pCAGGS vector