pYD1 - 2ug

https://www.gentaur.be/web/image/product.template/2363/image_1920?unique=196e103

2227,84 zł 2227.84 PLN 2227,84 zł

472,00 €

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    pYD1

    Catalog No. PVT11284
    Packing 2ug

     

    pYD1 Information

    Function yeast plasmids

    Plasmid type: yeast expression display system carrier

    High copy / low copy: high copy

    Promoter: CMV

    Cloning methods: polyclonal sites, restrictive endonucleases

    Carrier size: 5009bp

    5'sequencing primers and sequences: pYD1-F: AGTAACGTTTGTCAGTAATTGC

    3'sequencing primers and sequences: pYD1-R: GTCGATTTTGTTACATCTACAC

    Carrier label: C-His

    Carrier resistance: ampicin

    Screening markers: TRP1

    Note: the Saccharomyces cerevisiae is EBY100.

    Product directory number: V835-01

    Stability: stable expression

    Composition type: composition type

    Virus / non virus: non virus

     

    pYD1 Description


    pYD1 Sequence

    ACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTC
    GCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGT
    TATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATG
    ATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGAT
    ATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAAT
    GTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCGGAC
    TACTAGCAGCTGTAATACGACTCACTATAGGGAATATTAAGCTAATTCTACTTCATACATTTTCAATTAAGATGCAG
    TTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTAGCACAGGAACTGACAACTATATGCGAGCAAAT
    CCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAG
    GAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGC
    CCCATAAACACACAGTATGTTTTTAAGCTTCTGCAGGCTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGG
    TGGTGGTTCTGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGTACCAGGAT
    CCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCTTCGAAGGTAAGCCT
    ATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTG
    ATCTGATAACAACAGTGTAGATGTAACAAAATCGACTTTGTTCCCACTGTACTTTTAGCTCGTACAAAATACAATAT
    ACTTTTCATTTCTCCGTAAACAACATGTTTTCCCATGTAATATCCTTTTCTATTTTTCGTTCCGTTACCAACTTTAC
    ACATACTTTATATAGCTATTCACTTCTATACACTAAAAAACTAAGACAATTTTAATTTTGCTGCCTGCCATATTTCA
    ATTTGTTATAAATTCCTATAATTTATCCTATTAGTAGCTAAAAAAAGATGAATGTGAATCGAATCCTAAGAGAATTG
    GGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACCTATTTCTTAGCATTTTTGACGAAATTTGCT
    ATTTTGTTAGAGTCTTTTACACCATTTGTCTCCACACCTCCGCTTACATCAACACCAATAACGCCATTTAATCTAAG
    CGCATCACCAACATTTTCTGGCGTCAGTCCACCAGCTAACATAAAATGTAAGCTCTCGGGGCTCTCTTGCCTTCCAA
    CCCAGTCAGAAATCGAGTTCCAATCCAAAAGTTCACCTGTCCCACCTGCTTCTGAATCAAACAAGGGAATAAACGAA
    TGAGGTTTCTGTGAAGCTGCACTGAGTAGTATGTTGCAGTCTTTTGGAAATACGAGTCTTTTAATAACTGGCAAACC
    GAGGAACTCTTGGTATTCTTGCCACGACTCATCTCCGTGCAGTTGGACGATATCAATGCCGTAATCATTGACCAGAG
    CCAAAACATCCTCCTTAGGTTGATTACGAAACACGCCAACCAAGTATTTCGGAGTGCCTGAACTATTTTTATATGCT
    TTTACAAGACTTGAAATTTTCCTTGCAATAACCGGGTCAATTGTTCTCTTTCTATTGGGCACACATATAATACCCAG
    CAAGTCAGCATCGGAATCTAGAGCACATTCTGCGGCCTCTGTGCTCTGCAAGCCGCAAACTTTCACCAATGGACCAG
    AACTACCTGTGAAATTAATAACAGACATACTCCAAGCTGCCTTTGTGTGCTTAATCACGTATACTCACGTGCTCAAT
    AGTCACCAATGCCCTCCCTCTTGGCCCTCTCCTTTTCTTTTTTCGACCGAATTTCTTGAAGACGAAAGGGCCTCGTG
    ATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGGACGGATCGCTTGCCTGTAACTTACACGC
    GCCTCGTATCTTTTAATGATGGAATAATTTGGGAATTTACTCTGTGTTTATTTATTTTTATGTTTTGTATTTGGATT
    TTAGAAAGTAAATAAAGAAGGTAGAAGAGTTACGGAATGAAGAAAAAAAAATAAACAAAGGTTTAAAAAATTTCAAC
    AAAAAGCGTACTTTACATATATATTTATTAGACAAGAAAAGCAGATTAAATAGATATACATTCGATTAACGATAAGT
    AAAATGTAAAATCACAGGATTTTCGTGTGTGGTCTTCTACACAGACAAGATGAAACAATTCGGCATTAATACCTGAG
    AGCAGGAAGAGCAAGATAAAAGGTAGTATTTGTTGGCGATCCCCCTAGAGTCTTTTACATCTTCGGAAAACAAAAAC
    TATTTTTTCTTTAATTTCTTTTTTTACTTTCTATTTTTAATTTATATATTTATATTAAAAAATTTAAATTATAATTA
    TTTTTATAGCACGTGATGAAAAGGACCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT
    TTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAA
    GAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACC
    CAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAAC
    AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGG
    CGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTG
    AGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATG
    AGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACAT
    GGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCA
    CGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAA
    TTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGC
    TGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTA
    TCGTAGTTATCTACACGACGGGCAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
    CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATT
    TAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAG
    CGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACA
    AAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTT
    CAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCAC
    CGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG
    GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA
    GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGG
    CGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGGAACGCCTGGTAT
    CTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCCGAGCCT
    ATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTG
    CGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACC
    GAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGAT
    TCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTACC
    TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCCTATGTTGTGTGGAATTGTGAGCGGATAACAA
    TTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTGGC
    TAGT

    //
     

    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.