
1397,12 zł 1397.1200000000001 PLN 1397,12 zł

296,00 €

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    pIRES2- DsRed- Express Plasmid

    PVT1229      2ug

    pIRES2- DsRed- Express Plasmid Informaiton

    Promoter: CMV

    Replicon: pUC ori, F1 ori

    Terminator: SV40 poly (A) signal

    Plasmid classification: mammalian cells, fluorescent protein reporter vectors

    Plasmid size: 5264bp

    Prokaryotic resistance: Kan

    Selection marker: Neo

    Clonal strain: DH5 alpha

    Culture conditions: 37 C, aerobic LB

    Expression host: lactation cells

    Induction mode: no need to induce, transient expression.

    5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

    Primers for 3'sequencing: primers designed based on sequences


    pIRES2- DsRed- Express Plasmid Description

    pIRES2- DsRed- Express Plasmid contains the internal ribosome entry site (IRES; 1, 2) of the encephalomyocarditis virus (ECMV) between the MCS and a mutant of the Discosoma sp. red fluorescent protein DsRed-Express coding region (3–5). This permits both the gene of interest (cloned into the MCS) and the DsRed-Express gene to be translated from a single bicistronic mRNA. pIRES2-DsRed-Express is designed for the efficient selection by flow cytometry of transiently transfected mammalian cells expressing DsRed-Express and the protein of interest. This vector can also be used to express DsRed-Express alone or to obtain stably transfected cell lines without timeconsuming drug and clonal selection.


    pIRES2- DsRed- Express Plasmid Multiple cloning site



    pIRES2- DsRed- Express Plasmid Sequence

    LOCUS       Exported                5264 bp ds-DNA     circular SYN 01-SEP-2016

    DEFINITION  synthetic circular DNA


    VERSION     .

    KEYWORDS    Untitled 7

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 5264)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported Thursday, September 1, 2016 from SnapGene Viewer 3.1.4

    FEATURES             Location/Qualifiers

         source          1..5264

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         enhancer        61..364

                         /note="CMV enhancer"

                         /note="human cytomegalovirus immediate early enhancer"

         promoter        365..568

                         /note="CMV promoter"

                         /note="human cytomegalovirus (CMV) immediate early 


         misc_feature    609..665


                         /note="multiple cloning site"

         misc_feature    667..1253


                         /note="internal ribosome entry site (IRES) of the 

                         encephalomyocarditis virus (EMCV)"

         CDS             1254..1931


                         /product="rapidly maturing tetrameric variant of DsRed 

                         fluorescent protein (Bevis and Glick, 2002)"


                         /note="mammalian codon-optimized"






         polyA_signal    2052..2173

                         /note="SV40 poly(A) signal"

                         /note="SV40 polyadenylation signal"

         rep_origin      complement(2180..2635)


                         /note="f1 ori"

                         /note="f1 bacteriophage origin of replication; arrow 

                         indicates direction of (+) strand synthesis"

         promoter        2662..2766


                         /note="AmpR promoter"

         promoter        2768..3125

                         /note="SV40 promoter"

                         /note="SV40 enhancer and early promoter"

         rep_origin      2976..3111

                         /note="SV40 ori"

                         /note="SV40 origin of replication"

         CDS             3160..3954


                         /gene="aph(3')-II (or nptII)"

                         /product="aminoglycoside phosphotransferase from Tn5"


                         /note="confers resistance to neomycin, kanamycin, and G418 







         polyA_signal    4186..4233

                         /note="HSV TK poly(A) signal"

                         /note="herpes simplex virus thymidine kinase 

                         polyadenylation signal (Cole and Stacy, 1985)"

         rep_origin      4562..5150



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



            1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

           61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

          121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

          181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

          241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

          301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

          361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

          421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

          481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

          541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta

          601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg

          661 gatccgcccc tctccctccc ccccccctaa cgttactggc cgaagccgct tggaataagg

          721 ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg gcaatgtgag

          781 ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt cccctctcgc

          841 caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg aagcttcttg

          901 aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac ctggcgacag

          961 gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg cacaacccca

         1021 gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct caagcgtatt

         1081 caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg atctggggcc

         1141 tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aaacgtctag gccccccgaa

         1201 ccacggggac gtggttttcc tttgaaaaac acgatgataa tatggccaca accatggcct

         1261 cctccgagga cgtcatcaag gagttcatgc gcttcaaggt gcgcatggag ggctccgtga

         1321 acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag ggcacccaga

         1381 ccgccaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac atcctgtccc

         1441 cccagttcca gtacggctcc aaggtgtacg tgaagcaccc cgccgacatc cccgactaca

         1501 agaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg

         1561 gcgtggtgac cgtgacccag gactcctccc tgcaggacgg ctccttcatc tacaaggtga

         1621 agttcatcgg cgtgaacttc ccctccgacg gccccgtaat gcagaagaag actatgggct

         1681 gggaggcctc caccgagcgc ctgtaccccc gcgacggcgt gctgaagggc gagatccaca

         1741 aggccctgaa gctgaaggac ggcggccact acctggtgga gttcaagtct atctatatgg

         1801 ccaagaagcc cgtgcagctg cccggctact actacgtgga ctccaagctg gacatcacct

         1861 cccacaacga ggactacacc atcgtggagc agtacgagcg cgccgagggc cgccaccacc

         1921 tgttcctgta gcggccgcga ctctagatca taatcagcca taccacattt gtagaggttt

         1981 tacttgcttt aaaaaacctc ccacacctcc ccctgaacct gaaacataaa atgaatgcaa

         2041 ttgttgttgt taacttgttt attgcagctt ataatggtta caaataaagc aatagcatca

         2101 caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca

         2161 tcaatgtatc ttaaggcgta aattgtaagc gttaatattt tgttaaaatt cgcgttaaat

         2221 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa

         2281 tcaaaagaat agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta

         2341 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca

         2401 ctacgtgaac catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat

         2461 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg

         2521 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc

         2581 acgctgcgcg taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcaggt

         2641 ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca

         2701 aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg

         2761 aagagtcctg aggcggaaag aaccagctgt ggaatgtgtg tcagttaggg tgtggaaagt

         2821 ccccaggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca

         2881 ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt

         2941 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt

         3001 ccgcccattc tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg

         3061 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt

         3121 gcaaagatcg atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg

         3181 cacgcaggtt ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag

         3241 acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt

         3301 tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc aagacgaggc agcgcggcta

         3361 tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg

         3421 ggaagggact ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt

         3481 gctcctgccg agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat

         3541 ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg

         3601 atggaagccg gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca

         3661 gccgaactgt tcgccaggct caaggcgagc atgcccgacg gcgaggatct cgtcgtgacc

         3721 catggcgatg cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc

         3781 gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat

         3841 attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc

         3901 gctcccgatt cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgagcggga

         3961 ctctggggtt cgaaatgacc gaccaagcga cgcccaacct gccatcacga gatttcgatt

         4021 ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac gccggctgga

         4081 tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccctagg gggaggctaa

         4141 ctgaaacacg gaaggagaca ataccggaag gaacccgcgc tatgacggca ataaaaagac

         4201 agaataaaac gcacggtgtt gggtcgtttg ttcataaacg cggggttcgg tcccagggct

         4261 ggcactctgt cgatacccca ccgagacccc attggggcca atacgcccgc gtttcttcct

         4321 tttccccacc ccacccccca agttcgggtg aaggcccagg gctcgcagcc aacgtcgggg

         4381 cggcaggccc tgccatagcc tcaggttact catatatact ttagattgat ttaaaacttc

         4441 atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc

         4501 cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt

         4561 cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac

         4621 cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct

         4681 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact

         4741 tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg

         4801 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata

         4861 aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga

         4921 cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag

         4981 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg

         5041 agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac

         5101 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca

         5161 acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg

         5221 cgttatcccc tgattctgtg gataaccgta ttaccgccat gcat


    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.