PGL3-NFKB PLASMID 2ug

https://www.gentaur.be/web/image/product.template/2596/image_1920?unique=d37d21f
(0 przegląd)

1600,08 zł 1600.08 PLN 1600,08 zł VAT Excluded

339,00 € VAT Excluded

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    pGL3-NFKB Plasmid

    PVT15896   2ug
     

     

    pGL3-NFKB Plasmid Information

    Promoter: NFKB

    Replicator: pUC

    Cloned strain: DH5a

    Culture conditions: 37℃

    Host: Mammalian cells

    Use: luciferase report

    Fragment Type: Promoter

    Fragment species: Sheep

    Prokaryotic resistance: Amp

    Fluorescent label: Fluc

     

    pGL3-NFKB Plasmid Description

    pGL3-NFKB Plasmid is a Promoter plasmid

     

    pGL3-NFKB Plasmid Sequence

    ggtaccaagatcagtgatgattgtgtcattaatcaaagattataattcatccatctgttctcctgaagtctgcctcctca
    gaaaggtaaggctaattttctaatccggggcagccacaggagaaactgaaatgagtgggaggggtggtaactgttttcac
    ttttgtcttcctgtttttttttttttttttttcagagcctgggaaagcaagtcagaatttccaatcttttccaattccca
    catgattccctaatttagaacgaacacagagaaaataaagtctgccttcctctgggtaagactccgaagcctgctgggga
    ttgcccccaccctcggacaaggaaccccccgcggagggggttgctccagtcccaccctcaccccgcacgaacgcttcttg
    ggcttggccttggggacaatattctggcgacgggtcacaggatggttaattagtggaaatgctttgtgcgagctggacca
    gcaggaaaccctggggacacaggcggggtgagcctgccgattcaaacccctggagggtcccggacctgctaaaacacaaacgtcaggctgcagggtcgaggctccagagatctacccctcggtgccttctgccacccattgccccggagggatgcctctt
    aaaccgaggagcctgggctcggttcgccagcgggagcggacgaggcacggagcctcggtccacactagcgtgcacccatcgtccgagcactgccaggtgaagtccgggcgctttcctttcccctctctgcctccagactggggggacaagaaatttaaaa
    aatgcttccgcggccccaaccaccacgaagcaccttcatcgattaggaagccgtgtggagtttagccacccggtgtttgc
    ggtcgaagcaggcccgagcctttcccagcgcagggcaggcagccgaagcccagcagctctggccctgttccagaccgggcccgaggtgacatcaccactcctccgatcggcgggagggggcccccgaaatcccctaaaaacattgtgagtaatcgcccggcccgccctccaggcggggcccagactcgcgagcgatccgtgctgcccagccagtcccgggagcggcgtccaggcgcgcggcgtctcggggcccagcgcggcgcgtacttgctcgcagggcccggcagcggcggcgcgcgccaccccctaggccctcgagtggcgcgctcttgtccctaacccaccgcgcggggcggcggcggcggcggcggcggcgacgcagcgcgcaggcgcggccggattcccggcagtgacgcggcggcgggcgcgcgcggcgcatttccgcctctggcgaatggctcgactgtagcgcgcgccgcgggcccagctgcgaccccggccccgcccccgggaccccggccatggacgacctcttccccctcatcttcccctcggagccggccccggcctcgggcccctatcaagcttggcattccggtactgttggtaaagccaccatggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaa
    aagctcccaatcatccaaaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgt
    cacatctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagacaattgcactga
    tcatgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgcat
    gccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattccatcacggttttgg
    aatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttctga
    ggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctattctccttcttcgccaaaagcactctgatt
    gacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctctaaggaagtcggggaagcggttgc
    caagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatcagctattctgattacacccgagg
    gggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacg
    ctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggttatgtaaacaatccggaagcgac
    caacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacacttcttcatcg
    ttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgctgaattggaatccatcttgctccaacac
    cccaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttgga
    gcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtgtaattctagagtcggggcggccggccgcttcgagcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttat
    ttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtg
    tgggaggttttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatccgtcgaccgatgcccttgagag
    ccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatg
    caactcgtaggacaggtgccggcagcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggc
    gagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctt
    tctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgt
    tcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcag
    cagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggc
    tacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatc
    cggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaag
    aagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagatta
    tcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagcccaagctaccatgataagtaagtaatattaaggtacgggaggtacttggagcggccgcaataaaatatctttattttcattacatctgtgtgttggttttttgtgtgaatcgatagtactaacatacgctctccatcaaaacaaaacgaaacaaaacaaactagcaaaataggctgtccccagtgcaagtgcaggtgccagaacatttctctatcgata
    //

    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
    3.  Shipping temperature is 2-8℃.