(0 przegląd)

1994,20 zł 1994.2 PLN 1994,20 zł VAT Excluded

422,50 € VAT Excluded

Not Available For Sale

    Ta kombinacja nie istnieje.

    Terms and Conditions
    Gwarantowany zwrot pieniędzy przez 30dni
    Wysyłka w ciągu 2-3 dni roboczych

    PiggyBac Dual promoter (PB513B-1)

    PVT1601   2ug


    PiggyBac Dual promoter (PB513B-1) Information

    Promoter: CMV promoter

    Replicator: pUC ori, F1 ori

    Terminator: SV40 poly (A) signal

    Plasmid classification: lactation series plasmids; lactation editing plasmids; lactation transposing plasmids

    Plasmid size: 7258bp

    Prokaryotic resistance: ampicillin Amp (100 u g/ml)

    Screening markers: green fluorescent protein CopGFP, purinamycin Puro (10ug/ml)

    Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

    Culture conditions: 37 centigrade, aerobic LB

    Expression host: mammalian cells such as 293T

    Culture conditions: 37 C, 5%CO2

    Induction mode: no induction, instantaneous expression

    5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

    3'sequencing primers: Sv40-polyA-R (GAAATTTGTGATGCTATTGC)


    PiggyBac Dual promoter (PB513B-1) Description

    PiggyBac Dual promoter (PB513B-1) is a plasmid for mammalian cell transposition experiment, located at the downstream of CMV promoter, MCS, so that the target gene or microRNA is more convenient to clone. The downstream EF-1 alpha core promoter starts the expression of GFP.

    The PiggyBac (PB) transposon is a mobile genetic element that efficiently transposes between vectors and chromosomes via a "cut and paste" mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeat sequences (ITRs) located on both ends of the transposon vector and efficiently moves the contents from the original sites and efficiently integrates them into TTAA chromosomal sites. The powerful activity of the piggyBac transposon system enables genes of interest between the two ITRs in the PB vector to be easily mobilized into target genomes.
          The unique features of piggyBac transposons are that there is NO Cargo Limit and it is also Reversible. Genomes containing an inserted piggyBac vector can be transiently re-transfected with the PB transposase expression vector. The PB transposase will remove the transposons from the genome, footprint-free.The Super PiggyBac transposase transient expression vector and PB513B-1 were co-transfected into HeLa cells and puromycin selection applied for 10 days (10ug/ml). Cells efficiently transposed were Puro resistant and GFP positive.



    PiggyBac Dual promoter (PB513B-1) Sequence

    LOCUS       Exported File           7258 bp ds-DNA    circular SYN 24-5-2015

    KEYWORDS    PiggyBac Dual promoter(PB513B-1)

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 7258)

      TITLE     Direct Submission

      JOURNAL   Exported 2015-5-24

    FEATURES             Location/Qualifiers

         source          1..7258

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         promoter        complement(1..105)


                         /note="AmpR promoter"

         rep_origin      complement(131..586)


                         /note="f1 ori"

                         /note="f1 bacteriophage origin of replication; arrow 

                         indicates direction of (+) strand synthesis"

         primer_bind     728..744

                         /note="M13 fwd"

                         /note="common sequencing primer, one of multiple similar 


         promoter        1442..1645

                         /note="CMV promoter"

                         /note="human cytomegalovirus (CMV) immediate early 


         CDS             3068..3121


                         /product="2A peptide from?Thosea asigna virus capsid 



                         /note="Eukaryotic ribosomes fail to insert a peptide bond 

                         between the Gly and Pro residues, yielding separate 





         CDS             3122..3721


                         /gene="pac from Streptomyces alboniger"

                         /product="puromycin N-acetyltransferase"


                         /note="confers resistance to puromycin"





         polyA_signal    3829..3950

                         /note="SV40 poly(A) signal"

                         /note="SV40 polyadenylation signal"

         primer_bind     complement(5237..5253)

                         /note="M13 rev"

                         /note="common sequencing primer, one of multiple similar 


         protein_bind    5261..5277

                         /bound_moiety="lac repressor encoded by lacI"

                         /note="lac operator"

                         /note="The lac repressor binds to the lac operator to 

                         inhibit transcription in E. coli. This inhibition can be 

                         relieved by adding lactose or 

                         isopropyl-beta-D-thiogalactopyranoside (IPTG)."

         promoter        complement(5285..5315)

                         /note="lac promoter"

                         /note="promoter for the E. coli lac operon"

         protein_bind    5330..5351

                         /bound_moiety="E. coli catabolite activator protein"

                         /note="CAP binding site"

                         /note="CAP binding activates transcription in the presence 

                         of cAMP."

         rep_origin      complement(5639..6227)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(6398..7258)





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"








            1 actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata

           61 catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa

          121 agtgccacct aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa

          181 atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa

          241 tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac

          301 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa

          361 ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct

          421 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa

          481 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc

          541 gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgccattc

          601 aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg

          661 gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca

          721 cgacgttgta aaacgacggc cagtgagcgc gcctcgttca ttcacgtttt tgaacccgtg

          781 gaggacgggc agactcgcgg tgcaaatgtg ttttacagcg tgatggagca gatgaagatg

          841 ctcgacacgc tgcagaacac gcagctagat taaccctaga aagataatca tattgtgacg

          901 tacgttaaag ataatcatgc gtaaaattga cgcatgtgtt ttatcggtct gtatatcgag

          961 gtttatttat taatttgaat agatattaag ttttattata tttacactta catactaata

         1021 ataaattcaa caaacaattt atttatgttt atttatttat taaaaaaaaa caaaaactca

         1081 aaatttcttc tataaagtaa caaaactttt atgagggaca gccccccccc aaagccccca

         1141 gggatgtaat tacgtccctc ccccgctagg gggcagcagc gagccgcccg gggctccgct

         1201 ccggtccggc gctccccccg catccccgag ccggcagcgt gcggggacag cccgggcacg

         1261 gggaaggtgg cacgggatcg ctttcctctg aacgcttctc gctgctcttt gagcctgcag

         1321 acacctgggg ggatacgggg aaaaggcctc caaggcctac tagtattatg cccagtacat

         1381 gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat

         1441 ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact cacggggatt

         1501 tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa atcaacggga

         1561 ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta ggcgtgtacg

         1621 gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcgcct ggagacgcca

         1681 tccacgctgt tttgacctcc atagaagatt ctagagctag cgaattcgaa tttaaatcgg

         1741 atccgcggcc gcaaggatct gcgatcgctc cggtgcccgt cagtgggcag agcgcacatc

         1801 gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaacgggtg cctagagaag

         1861 gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg

         1921 tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt

         1981 tgccgccaga acacagctga agcttcgagg ggctcgcatc tctccttcac gcgcccgccg

         2041 ccctacctga ggccgccatc cacgccggtt gagtcgcgtt ctgccgcctc ccgcctgtgg

         2101 tgcctcctga actgcgtccg ccgtctaggt aagtttaaag ctcaggtcga gaccgggcct

         2161 ttgtccggcg ctcccttgga gcctacctag actcagccgg ctctccacgc tttgcctgac

         2221 cctgcttgct caactctacg tctttgtttc gttttctgtt ctgcgccgtt acagatccaa

         2281 gctgtgaccg gcgcctacgc tagacgccac catggagagc gacgagagcg gcctgcccgc

         2341 catggagatc gagtgccgca tcaccggcac cctgaacggc gtggagttcg agctggtggg

         2401 cggcggagag ggcaccccca agcagggccg catgaccaac aagatgaaga gcaccaaagg

         2461 cgccctgacc ttcagcccct acctgctgag ccacgtgatg ggctacggct tctaccactt

         2521 cggcacctac cccagcggct acgagaaccc cttcctgcac gccatcaaca acggcggcta

         2581 caccaacacc cgcatcgaga agtacgagga cggcggcgtg ctgcacgtga gcttcagcta

         2641 ccgctacgag gccggccgcg tgatcggcga cttcaaggtg gtgggcaccg gcttccccga

         2701 ggacagcgtg atcttcaccg acaagatcat ccgcagcaac gccaccgtgg agcacctgca

         2761 ccccatgggc gataacgtgc tggtgggcag cttcgcccgc accttcagcc tgcgcgacgg

         2821 cggctactac agcttcgtgg tggacagcca catgcacttc aagagcgcca tccaccccag

         2881 catcctgcag aacgggggcc ccatgttcgc cttccgccgc gtggaggagc tgcacagcaa

         2941 caccgagctg ggcatcgtgg agtaccagca cgccttcaag acccccatcg ccttcgccag

         3001 atcccgcgct cagtcgtcca attctgccgt ggacggcacc gccggacccg gctccaccgg

         3061 atctcgcgag ggcagaggaa gtcttctaac atgcggtgac gtggaggaga atcccggccc

         3121 tatgaccgag tacaagccca cggtgcgcct cgccacccgc gacgacgtcc ccagggccgt

         3181 acgcaccctc gccgccgcgt tcgccgacta ccccgccacg cgccacaccg tcgatccgga

         3241 ccgccacatc gagcgggtca ccgagctgca agaactcttc ctcacgcgcg tcgggctcga

         3301 catcggcaag gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga ccacgccgga

         3361 gagcgtcgaa gcgggggcgg tgttcgccga gatcggcccg cgcatggccg agttgagcgg

         3421 ttcccggctg gccgcgcagc aacagatgga aggcctcctg gcgccgcacc ggcccaagga

         3481 gcccgcgtgg ttcctggcca ccgtcggcgt ctcgcccgac caccagggca agggtctggg

         3541 cagcgccgtc gtgctccccg gagtggaggc ggccgagcgc gccggggtgc ccgccttcct

         3601 ggagacctcc gcgccccgca acctcccctt ctacgagcgg ctcggcttca ccgtcaccgc

         3661 cgacgtcgag gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc ccggtgcctg

         3721 aaatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc

         3781 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcagttaa cttgtttatt

         3841 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt

         3901 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg

         3961 aattgactca aatgatgtca attagtctat cagaagctat ctggtctccc ttccggggga

         4021 caagacatcc ctgtttaata tttaaacagc agtgttccca aactgggttc ttatatccct

         4081 tgctctggtc aaccaggttg cagggtttcc tgtcctcaca ggaacgaagt ccctaaagaa

         4141 acagtggcag ccaggtttag ccccggaatt gactggattc cttttttagg gcccattggt

         4201 atggcttttt ccccgtatcc ccccaggtgt ctgcaggctc aaagagcagc gagaagcgtt

         4261 cagaggaaag cgatcccgtg ccaccttccc cgtgcccggg ctgtccccgc acgctgccgg

         4321 ctcggggatg cggggggagc gccggaccgg agcggagccc cgggcggctc gctgctgccc

         4381 cctagcgggg gagggacgta attacatccc tgggggcttt gggggggggc tgtccctgat

         4441 atctataaca agaaaatata tatataataa gttatcacgt aagtagaaca tgaaataaca

         4501 atataattat cgtatgagtt aaatcttaaa agtcacgtaa aagataatca tgcgtcattt

         4561 tgactcacgc ggtcgttata gttcaaaatc agtgacactt accgcattga caagcacgcc

         4621 tcacgggagc tccaagcggc gactgagatg tcctaaatgc acagcgacgg attcgcgcta

         4681 tttagaaaga gagagcaata tttcaagaat gcatgcgtca attttacgca gactatcttt

         4741 ctagggttaa tctagctgca tcaggatcat atcgtcgggt cttttttccg gctcagtcat

         4801 cgcccaagct ggcgctatct gggcatcggg gaggaagaag cccgtgcctt ttcccgcgag

         4861 gttgaagcgg catggaaaga gtttgccgag gatgactgct gctgcattga cgttgagcga

         4921 aaacgcacgt ttaccatgat gattcgggaa ggtgtggcca tgcacgcctt taacggtgaa

         4981 ctgttcgttc aggccacctg ggataccagt tcgtcgcggc ttttccggac acagttccgg

         5041 atggtcagcc cgaagcgcat cagcaacccg aacaataccg gcgacagccg gaactgccgt

         5101 gccggtgtgc agattaatga cagcggtgcg gcgctgggat attacgtcag cgaggacggg

         5161 tatcctggct ggatgccgca gaaatggaca tggatacccc gtgagttacc cggcgggcgc

         5221 gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc

         5281 cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct

         5341 aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc

         5401 agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt

         5461 ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag

         5521 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca

         5581 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt

         5641 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc

         5701 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct

         5761 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg

         5821 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca

         5881 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact

         5941 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta

         6001 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta

         6061 actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct

         6121 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt

         6181 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga

         6241 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca

         6301 tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat

         6361 caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg

         6421 cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt

         6481 agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag

         6541 acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc

         6601 gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag

         6661 ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca

         6721 tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa

         6781 ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga

         6841 tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata

         6901 attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca

         6961 agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg

         7021 ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg

         7081 ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg

         7141 cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag

         7201 gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcat



    Product is for research use only!