Skip to Content

pQE-30 plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/20236/image_1920?unique=325b45d
(0 review)

0.00 zł 0.0 PLN 0.00 zł Tax Excluded

poland@gentaur.com

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Promoter: T5


    Replicon: ColE1 ori


    Terminator: lambda t0 Terminator


    Plasmid classification: Escherichia coli plasmids; large intestine expression plasmids; pQE series plasmids


    Plasmid size: 3461bp


    Plasmid label: N-His


    Prokaryotic resistance: ampicillin Amp (100 u g/ml)


    Cloned strains of Escherichia coli, DH5 A and other Escherichia coli


    Culture conditions: 37 centigrade, aerobic, LB


    Expression host: M15


    Culture conditions: 37 centigrade, aerobic, LB


    Inducement: IPTG or lactose and its analogues


    5'sequencing primers: pQE30-F (TGAGCGGATAACAATTTCAC)


    3'sequencing primers: pQE -R (GTTCTGAGGTCATTACTGG)