Skip to Content

pEE12.4 Plasmid - 2 ug

https://www.gen.bg/web/image/product.template/14669/image_1920?unique=325b45d
(0 review)

0.00 zł 0.0 PLN 0.00 zł Tax Excluded

poland@gentaur.com

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    pEE12.4 Information

    Promoter: hCMV-MIE

    Replicator: Pee6 ori

    Terminator: SV40, poly (A) signal

    Plasmid classification: mammalian cells, antibody expression vectors

    Plasmid size: 7569bp

    Prokaryotic resistance: Amp

    Clone strain: DH5 alpha

    Culture conditions: 37 DEG C, aerobic LB

    Expression host: mammalian cells

    Induction mode: no induction, transient expression

    Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG

    Primers for 3'sequencing: according to sequences